• AgoraVox sur Twitter
  • RSS
  • Agoravox TV Mobile

Accueil du site > Tribune Libre > Témoignage d’une infirmière lanceuse d’alerte licenciée

Témoignage d’une infirmière lanceuse d’alerte licenciée

Vidéo d’une infirmière : Céline a été remerciée suite à une vidéo diffusée sur Youtube.....

Témoignage d’une infirmière de Nice sur l’arnaque des tests PCR

Tags : Covid-19




Réagissez à l'article

70 réactions à cet article    


  • 2 votes
    personne 16 mars 10:46

    Pour être plus précis : "Le CDC (Centers for Disease Control and Prevention) estime, quant à lui, qu’il est extrêmement difficile de détecter du virus vivant au-delà de 33 cycles...En France, le nombre de cycles Ct est fixé à 35 : avec une détection en dessous de 35 cycles le test PCR est considéré positif, au dessus le PCR est considéré négatif...Les personnes détectées entre 24 et 35 cycles sont donc dans une zone grise en termes virologique comme épidémiologique...Dans un fact-checking du journal Le Monde daté du 9 septembre, le docteur Yazdan Yazdanpanah, chef du service des maladies infectieuses et tropicales de l’hôpital Bichat et membre du conseil scientifique, estime qu’il est presque acquis actuellement qu’en dessous de 24 cycles, on est contagieux ! " Pas possible d’être taxé de complotiste 

    Source : Alternativesante


    • 1 vote
      sls0 sls0 16 mars 12:01

      @personne
      Pour renforcer le commentaire de personne :
      http://www.biovsm.fr/bim.asp?page=45
      Le Ct est variable d’un réactif à un autre et la qualité et la quantité du prélèvement jouent aussi.

      Valeur du Ct

      Estimation semi-quantitative

      Ct < 10

      Présence d’ARN viral en quantité très importante

      10 ≤ Ct < 25

      Présence d’ARN viral du SARS-CoV-2

      Ct ≥ 25

      Présence d’ARN viral du SARS-CoV-2 en faible quantité


      J’ai fait un test à l’étranger pour prendre l’avion, j’ai payé 4000 pesos ou 57€, la Ct de mémoire était indiquée.
      Si j’ai bien compris, c’est plus cher et il y a plus d’arnaques en France que dans un pays pauvre considéré comme corrompu.

    • 7 votes
      juanyves 16 mars 13:06

      @sls0 On s’en fout de tes pesos, c’est pour nous faire croire tes salades sur ton retour d’un pays où tu es allé faire le touriste et tes conn eries sur ta vie d’ascète depuis ton retour. De plus, vu ta mémoire défaillante et corrompue, ne parles pas de chose "de mémoire", c’est pas fiable.


    • 1 vote
      personne 16 mars 14:12

      @sls0
      C’est pour cette raison que l’infirmière précise qu’il doit être indiqué que le résultat doit être considéré en fonction des signes cliniques ! D’ailleurs fut un temps ou le médecin pratiquait l’anamnèse de façon poussée juqu’à comprendre la psychologie du patient et son contexte de vie
      En France 73 euros le test, faut bien engraisser les copains !


    • vote
      sls0 sls0 16 mars 14:57

      @juanyves
      Quand on parle au charcutier, l’andouille ferme sa gueule.

      Il m’aime pas le juanyves, comme ses arguments sont de piètre qualité il lui reste que l’attaque ad personam.
      Du petit, du mesquin, qu’attendre de plus de la part d’un nain.


    • 7 votes
      Super Cochon Super Cochon 16 mars 15:45

      .
      .
      VOICI le Lien de la vidéo sur Odysse.com au cas ou elle serait censurée par Youtube !
      .
      .
      VIDEO — 13 minutes
      .
      .
      https://odysee.com/@ShiningTraduction:b/projetPCR:1

      .
      .


    • 7 votes
      Super Cochon Super Cochon 16 mars 15:47

      @sls0
      .
      .
      Merci , mais le Professeur Raoult nous l’a expliqué avant toi !
      .
      .
      .


    • vote
      sls0 sls0 16 mars 16:22

      @Super Cochon
      C’est la preuve qu’il ne dit pas que des conneries.
      J’ai quelques doutes quand même, tu mets le lien vers son analyse.


    • 7 votes
      Super Cochon Super Cochon 16 mars 16:36

      @sls0
      .
      .
      Si tu me le demande , ça signifie que tu ne regardes pas les vidéos de Raoult ! ....... DONC , tu ne parles pas en connaissances de cause quand tu critiques ses vidéos !
      .
      .
      .
      CQFD ! ....... Paumé , qui n’as rien à faire de ses journées !
      .
      .
      .


    • vote
      sls0 sls0 16 mars 18:14

      @Super Cochon
      Le Raoult j’ai écouté au début mais vu le nombre de conneries et de mensonges à la minute j’ai laissé tombé.
      Par contre toi l’assidu, le fan il te serait facile de mettre le lien que je t’ai demandé.
      A priori tu regardes et tu piges que dalle, vu ta stupidité ça peut se comprendre, je suis pas prêt à avoir ce lien.
      Il se peut aussi que tu en ais les capacités mais que tu tombes en trance dès que saint Raoult le même que tu t’es fait tatouer parait à l’écran, ça perturbe.

      Pour ce qui est de dire que les vidéos de Raoult c’est de la merde et que c’est un faussaire, je l’ai assez dit en mars, je n’ai plus a revenir dessus.
      Mon gros, c’est toi qui dit que raoult l’a dit, c’est à toi à le prouver. Ce qui est affirmé sans preuve peut être rejeté sans preuve. Euclide.


    • vote
      sls0 sls0 16 mars 18:20

      @Super Cochon
      Au fait après un vie professionnel bien remplie, je profite de ma retraite ce qui me permet et donne le droit de rien faire de mes journées surtout qu’il pleut aujourd’hui.
      A ton âge si tu ne fous rien de tes journées c’est parce que tu parasites la société.


    • 6 votes
      Super Cochon Super Cochon 16 mars 18:24

      @sls0
      .
      .
      Entre toi et Raoult , la question ne se pose même pas !
      .
      .
      .


    • 5 votes
      Super Cochon Super Cochon 16 mars 18:31

      @sls0
      .
      .
      ." Au fait après un vie professionnel bien remplie , je profite de ma retraite ce qui me permet et donne le droit de rien faire de mes journées surtout qu’il pleut aujourd’hui. .... bla bla bla .... "
      .
      .
      _________________________________________

      .
      .
      Vu ta réaction ....... j’ai mis dans le mille !
      .
      .


    • 5 votes
      Berthier Berthier 16 mars 18:56

      @Ciseaux
       
      « Au fait après un vie professionnel bien remplie, je profite de ma retraite »
       
      Tiens donc ! Alors comme ça vous êtes à la retraite ? Ils vont m’entendre à la compta ils ne m’ont même pas prévenu !
       

       
      Bon, ben qu’est-ce que vous fichez encore ici, Ciseaux ?...
       


    • vote
      sls0 sls0 16 mars 20:53

      @Super Cochon
      Si le but de ton intervention c’était montrer que tu parasites la société effectivement t’as mis dans le mille.


    • 1 vote
      tobor tobor 16 mars 23:52

      @sls0
      "Si le but de ton intervention c’était montrer que tu parasites la société effectivement t’as mis dans le mille."

      Retraité ou pas, là c’est vraiment des enfantillages, tous les deux d’ailleurs, vous feriez sans-doute mieux de vous ignorer plutôt que de vous fantasmer !


    • vote
      bubu12 16 mars 11:21

      Elle dit elle même qu’elle n’y connait rien à l’analyse et l’interprétation des tests, vous avez pas plutôt un biologiste pour en parler ?


      • vote
        sls0 sls0 16 mars 12:14

        @bubu12
        Je ne suis pas biologiste mais j’aime bien les statistiques. Je me suis intéressé au test CPR pour voir son taux de faux positif qui impose une prévalence minimum pour être significatif.
        Le Ct est important vis à vis des faux positifs.

        Déjà avec une prévalence faible les tests CPR c’est difficilement justifiable si on plus on augmente les faux positifs via un Ct important on risque d’être dans les choux.
        Un petit rappel sympa sur la loi de Bays avec un exemple sur les tests justement :
        https://youtu.be/3FOrWMDL8CY


      • vote
        bubu12 16 mars 13:41

        @pegase

        vous répétez comme un perroquet quelque chose que vous ne comprenez même pas !
        la personne de la vidéo dit au dessus de 25 cycles ca veut rien dire et après nous explique qu’elle n’y connait rien a l’interprétation des tests, c’est du coup une source fiable assurément !

        elle dit au début de la vidéo qu’elle fait des tests sur des gens qui n’ont pas l’air malade donc que ca ne sert à rien, elle a sans doute oublié qu’on peut être contagieux avant que la maladie ne montre les premiers symptômes. Si on test les cas contacts c’est pas pour faire jolie hein.


      • 4 votes
        Tchakpoum Tchakpoum 16 mars 13:46

        @bubu12

        la fiabilité éventuelle des tests PCR réalisés dépend, d’emblée, du seuil de cycles d’amplification qu’ils portent, de telle sorte que, jusqu’à la limite de 25 cycles, la fiabilité du test sera d’environ 70% ; si 30 cycles sont effectués, le degré de fiabilité tombe à 20% ; si 35 cycles sont atteints, le degré de fiabilité sera de 3%.

        C’est le constat conclusif de cette étude :
        https://academic.oup.com/cid/advance-article/doi/10.1093/cid/ciaa1491/5912603

        C’est là-dessus qu’un arrêt de justice a été rendu à la cour d’appel de Lisbonne, à la suite d’un confinement d’un touriste testé positif au PCR, alors qu’il ne l’était pas : on ne peut plus confiner quelqu’un sur un résultat PCR et ce test ne peut pas être reconnu comme diagnostic médical.
        http://www.dgsi.pt/jtrl.nsf/33182fc732316039802565fa00497eec/79d6ba338dcbe5 e28025861f003e7b30
        .
        Le résumé de cet arrêt ici :
        https://www.francesoir.fr/opinions-tribunes/les-implications-capitales-de-la-jurisprudence-portugaise-concernant-les-tests-pcr#_ftn4

        Et j’ajoute que le Portugal est le pays qui a la plus faible mortalité/covid par Mo d’habitants, hormis le pic exceptionnel du 1er février.

        Une plainte est déposée aussi en Allemagne pour utilisation incorrecte et abusive des tests PCR, et ça commence à tanguer. Aux US, idem.
        https://www.francesoir.fr/societe-sante/le-test-pcr-va-au-tribunal-au-portugal-mais-aussi-en-allemagne-et-dans-de-nombreux

        En France, l’autorité n’a jamais arrêté aux labos médicaux le nombre de cycles demandés. Libre choix est laissé aux labos et des coups de pressions diverses et variées sont donc possibles.

        Et ça pose un problème.
        https://ourworldindata.org/coronavirus
        + Dans le graphique qui apparaît, en dessous, écrivez juste en haut à gauche, dans la fenêtre de recherche "Type to add a country" : "France" et cliquez sur ce mot qui apparaît en dessous en surligné (pas la case à cocher, le mot directement).
        ==> Vous constatez une augmentation lente et régulière des cas confirmés depuis le 28 décembre.
        + Au du graphique, sous la liste déroulante "METRIC", sélectionnez : "Confirmed death"
        ==> Vous constatez une diminution lente des décès à partir du 3 février.
        >>> Cclusion : il y a un écart croissant en France entre le nombre de cas déclarés et le nombre de décédés.

        D’autre part.
        Ca cause pas mal sur twitter et ça commence à sortir sur les plateaux tévés : on place directement les malades dans les salles de réas, sans passer par la case "urgences", on ralentit les sorties des patients des salles de réas, etc... Bref, il semble qu’on remplisse les salles de réas avec des malades sans nécessité, pour gonfler les chiffres.


      • 7 votes
        Berthier Berthier 16 mars 13:51

        @Bubut
         
        « Si on test les cas contacts c’est pas pour faire jolie hein. »
         
        Si, mais on s’en fout mon vieux. Je veux un topo sur la fiabilité des tests sur mon bureau avant la fin de la semaine, Bubut !
         


      • vote
        bubu12 16 mars 14:23

        @Tchakpoum

        le problème c’est que les médias racontent n’importe quoi sur les PCR et pas grand monde y comprend quelque chose.
        je vous laisse lire ce threat intéressant : https://twitter.com/arikouts/status/1364941785500446725

        on place directement les malades dans les salles de réas, sans passer par la case "urgences", on ralentit les sorties des patients des salles de réas, etc... Bref, il semble qu’on remplisse les salles de réas avec des malades sans nécessité, pour gonfler les chiffres.

        C’est impossible, on ne rentre pas en réa comme ca, tout cette fable par du fait qu’un urologue a dit sur CNEWS que d’après certains bruits qui courent les criteres d’admissions en rea auraient changés. Il me faudra plus que " des bruits" pour le croire


      • 4 votes
        Tchakpoum Tchakpoum 16 mars 14:37

        @bubu12

        le problème c’est que les médias racontent n’importe quoi sur les PCR et pas grand monde y comprend quelque chose.

        Bah, c’est fait pour non ?

        C’est impossible

        Un écart croissant entre le taux de contaminés et un taux de mortalité est impossible aussi. Tout a plus un effet de retard à 3 semaines entre la contamination et la mort.
        Si cet impossible là est devenu possible, plein d’autre choses sont possibles.
        Par exemple, on ne parle même plus des cliniques qui proposent des lits de réa qui ne sont pas utilisés.
        Par exemple encore, on ne parle pas des lits de réas qui continuent à baisser dans les hôpitaux de France, en 2019 comme en 2020.
        Par exemple encore, si Macron a emprunté 127 milliards pour ne même pas arrêter la baisse des lits de réas, ou payer les cliniques, alors que tout le blocage en France est lié à la crainte de dépassement des capacités des salles de réas à accueillir les malades, il n’y a plus de sens à rien.


      • 6 votes
        wendigo wendigo 16 mars 17:19

        @bubu12

         Le type qui ne pane rien à rien de sujets en sujets et qui vient reprocher à quelqu’un qui le reconnaît de ne pas être expert !
         C’est pas le culot qui t’étouffe visiblement !


      • 5 votes
        wendigo wendigo 16 mars 17:24

        @bubu12
        "C’est impossible, on ne rentre pas en réa comme ca, tout cette fable par du fait qu’un urologue a dit sur CNEWS que d’après certains bruits qui courent les criteres d’admissions en rea auraient changés. Il me faudra plus que " des bruits" pour le croire"

         Hé bé, tu peux dire de mon orthographe .....
         Pourquoi attendre les bruits de couloir, t’a qu’à demander à ta femme, à moins qu’elle ait changé de taf entre avant hier et aujourd’hui .


      • 6 votes
        ZardoZ ZardoZ 16 mars 18:28

        @wendigo
         
        Ahhh... La femme à Bubule le moussaillon, c’est comme la femme du lieutenant Columbo de la criminelle, insaisissable, mais toujours si présente. 

         smiley

      • 2 votes
        bubu12 16 mars 19:24

        @wendigo et ZardoZ

        les trolls se vautrent dans l’attaque personnelle faute d’avoir quelque chose d’intéressant à dire, comme d’habitude


      • 2 votes
        ZardoZ ZardoZ 16 mars 19:49

        @bubule le psy en devenir,

        Met nous une photo de ta femme en lien, si possible avec tout son attirail de jeune doctoresse qui se la pète comme dans les sitcoms pour neuneus made in US.

         smiley

      • 3 votes
        Berthier Berthier 16 mars 19:53

        @Bubut
         
        Ah tout de même mon vieux, Ouindigaux et Zardose ont eu la délicatesse de ne pas faire allusion à votre moustache assez disgracieuse il faut bien le dire !
         
        Du coup, je vais revérifier votre CV, Bubut, j’ai comme un doute sur vos compétences !...

         
        Si vous m’avez menti, vous en serez quitte pour votre solde de tout compte...
         


      • 6 votes
        ZardoZ ZardoZ 16 mars 19:54

        @bubule,

        Je te signale au passage que tu ne dis jamais rien d’intéressant, juste les resucées des merdias que tu affectionnes. 
        Par contre quand tu essayes maladroitement de faire ton mytho, nous rigolons bien à tes dépens. Et ça, c’est chouette

         smiley

      • 3 votes
        Vulpes vulpes Vulpes vulpes 16 mars 20:16

        @bubu12

        le problème c’est que les médias racontent n’importe quoi sur les PCR et pas grand monde y comprend quelque chose.

        je vous laisse lire ce threat intéressant : https://twitter.com/arikouts/status/1364941785500446725

         

        Ces tests ne diagnostiquent pas la maladie du COVID19, ils indiquent la présence ou non de virus SarsCov2.

        Avez-vous bien lu les tweets que vous recommandez ?

        Faites-vous parti de ceux qui n’y comprennent pas grande chose ?

        Un test PCR N’INDIQUE PAS LA PRÉSENCE OU NON DE VIRUS SarsCov2.


        Il détecte la présence de fragments de virus. Un peu de documentation ici et ici

        P.S. Attention, en anglais a threat se traduit par une menace


      • 4 votes
        Pyrathome Pyrathome 16 mars 20:18

        smileybubukiabu

        Tu oses parler de "trolls", mais c’est toi le troll ici avec ton alcoolique BozO.....la démonstration n’est plus à faire !


      • vote
        bubu12 16 mars 21:15

        @Vulpes vulpes

        vous ne faite pas beaucoup d’effort, 3eme tweet du thread il est écrit "  
        Le mot « positif » dans un test RT PCR est la présence, ou non, de fragments d’ARNs du virus. Il n’indique en rien qu’une personne a été, est ou va être malade, et ne donne qu’une info limitée sur la charge virale. Mais est-il inutile pour autant ?"


      • vote
        Vulpes vulpes Vulpes vulpes 16 mars 21:27

        @bubu12

        https://twitter.com/arikouts/status/1364943455332560906

        Il est par contre vrai que les médias n’utilisent pas toujours les bons termes, ces tests ne diagnostiquent pas la maladie du COVID19, ils indiquent la présence ou non de virus SarsCov2. Par exemple sur ces images le choix est mauvais. Et c’est dommage



      • 1 vote
        bubu12 16 mars 22:03

        @Vulpes vulpes

        si le test RT-PCR détecte le matériel génétique du virus vous en concluez quoi exactement ?


      • 2 votes
        Vulpes vulpes Vulpes vulpes 16 mars 22:22

        @bubu12


        Je l’ai précisé clairement précédemment. Le test détecte la présence de FRAGMENTS de virus.

        Donc la réponse à votre question est : Je conclue qu’il y a des fragments de virus dans la cellule !


      • vote
        bubu12 16 mars 22:46

        @Vulpes vulpes

        bonne lecture : https://www.pasteur.fr/fr/espace-presse/documents-presse/fonctionnement-fiabilite-tests-rt-pcr-detection-du-sars-cov-2

        extrait : Le CNR a développé deux tests RT-PCR, respectivement IP2 et IP4, dans le cadre de l’épidémie de Covid-19. Ces deux tests utilisent chacun trois séquences distinctes du génome du SARS-CoV-2. Il s’agit de deux séquences « amorces » qui permettent l’amplification d’une courte séquence du génome du virus et d’une séquence « sonde » qui permet la détection en venant se fixer sur les séquences amplifiées à l’aide des deux amorces. Il faut donc une correspondance du matériel génétique dans le prélèvement avec les trois séquences simultanément pour obtenir un résultat positif. Si l’une de ces trois séquences ne se fixe pas, aucun signal n’est détecté, le résultat est négatif.
         l’association des trois séquences est unique au SARS-CoV-2 et c’est cette singularité qui permet l’identification du virus dans les tests.


      • 3 votes
        Vulpes vulpes Vulpes vulpes 16 mars 23:10

        @bubu12

        Vous continuez de poster ce que vous ne lisez pas.

        Ce n’est pas sérieux de votre part et c’est la dernière fois que je réponds à une question qui montre que vous n’êtes pas au courant de ce que vous affirmez.

         

        Dans le cadre du test IP2, les trois séquences sont :

        - « CTCCCTTTGTTGTGTTGT » et « ATGAGCTTAGTCCTGTTG » qui comptent respectivement 18 et 17 nucléotides (ce sont les deux séquences amorces)

         et la séquence « AGATGTCTTGTGCTGCCGGTA [5’]Hex [3’]BHQ-1 qui compte 21 nucléotides (elle correspond à la séquence sonde).

        Le génome complet du SRAS-CoV-2 comprend un enchaînement de 30 000 bases

         

        Test sur 18+17+21 nucléotides sur 30.000 bases – JE VOUS LAISSE FAIRE LE CALCUL !


      • 1 vote
        bubu12 16 mars 23:27

        @Vulpes vulpes

        mais sérieusement ? 

        Comme le code génétique ne comporte que 4 bases (A, T, C, G), il arrive parfois que de petites séquences de nucléotides se retrouvent dans différents organismes, comme c’est le cas pour la séquence « CTCCCTTTGTTGTGTTGT ». En effet, l’homme mais aussi d’autres espèces animales comme le labrador retriever, le chat, le cochon… possèdent cette séquence dans leur génome.
        Par contre l’association des trois séquences est unique au SARS-CoV-2 et c’est cette singularité qui permet l’identification du virus dans les tests

        qu’est ce que vous ne comprenez pas dans la dernière phrase ? incroyable cette mauvaise foi. 


      • 1 vote
        wendigo wendigo 17 mars 06:43

        @bubu12
        "les trolls se vautrent dans l’attaque personnelle faute d’avoir quelque chose d’intéressant à dire, comme d’habitude"
        **
        je te l’ai déjà dit mon bonhomme, discuter avec toi c’est comme parler puiser de l’eau avec un panier ; c’est rigolo, mais inutile !
        Quant à prétendre que nous sommes des trolls, commence par publier des articles et participer à la modération et on verra après ; parce que pour l’instant celui qui affiche tous les artefacts du troll (pseudo y compris) je suis en train de lui répondre !
         Aussi , si Zardoz et moi participons à la modération des articles, toi tu pourrais commencer par modérer tes propos on n’est pas sur le JVD 15/18 !



Ajouter une réaction

Pour réagir, identifiez-vous avec votre login / mot de passe, en haut à droite de cette page

Si vous n'avez pas de login / mot de passe, vous devez vous inscrire ici.


FAIRE UN DON


Publicité





Palmarès